High Levels of Solar Radiation

1.  Solar Radiation is radiant energy from the sun, when there is too much of it, it can become a problem for many reasons. Too Much UV (Ultraviolet Radiation) can be very dangerous because it is something that can cause Skin Cancer. Melanin is a natural sunscreen to our skin that absorbs UV because it is not good for our skin, But when there is too much UV present our skin cells can lead to a mutation which would lead to Skin Cancer.

2. 

Short Term Adaptation

I don't think that for this case of high levels of solar radiation there is short term adaptation because our skin does not like the sun nor is the sun good for it so there I don't think there is a way to adapt.

Facultative Adaptation

Facultative adaptation would have to be melanin, which is a substance produced by cells called melanocytes. Melanin protects us from overexposure to uv radiation. The production of melanin varies from each individual for example men and women. Men tend to get tan easily as for women it takes them more. It occurs in all humans except albinos because they carry a mutation that prevents them from producing any melanin which explains why they are so pale. European descents only produce a small amount of melanin and when the sun exposure increases their melanin remains at the small amount and doesn't produce any more. 

Developmental Adaption

The levels of melanin are changes in the DNA and people from different areas or continents are different skin tones due to levels of melanin. Both dark and light complexions have melanin. There are two types produced pheomelanin and eumelanin. 

Cultural Adaptation

This is something easier that we can solve ourselves, in order to adapt I would use sunscreen, stay indoors or even use an umbrella to protect myself from high levels of solar radiation. I know some people even wear long sleeves or clothing to cover themselves so they do not expose too much.

3. I think that studying human variation can be very good because it teaches you why we are all made differently and look differently. Some don't understand why each race has different traits for example different skin color different hair types but I think these thing take a huge part on this because there are reasons behind each of these traits.

4. I would use race to understand environmental adaptations again, because it can show you why we each are made differently and the different traits each race has and why we have them. They each have a purpose for example how darker skin tones are there because it is to avoid sun burns etc. Understanding human variation without the use of race would probably be that we are all human beings who aren't really all that different but because we all live in different areas with different conditions we as humans have adapted to the environment over time.

Language Blog

Part 1:

This part of the assignment was very difficult and frustrating because it obviously wasn't easy to communicate with one another. It was very hard because you can be easily misunderstood since we weren't allowed to use language. My partner was getting kind of annoyed as well because they didn't understand a lot of what I was saying. My partner was in control since it was easier for them to switch topics and what not but in a normal conversation of course the power would be distributed but since I was the one who wasn't allowed to say anything they definitely had all of the power. I see different cultures communicating all the time especially when it comes down to deaf and hearing people, they have such different cultures and most of the time a hearing person does not know Sign Language so it is definitely hard for the to understand each other. Ive seen it happen many times especially when I attend deaf event for my ASL class.

Part 2:

The second part of this assignment was definitely a lot more interesting to me because I was the one not showing any facial expressions or body language etc. Im sure my partner had trouble deciding my mood in that conversation I didn't show any expression and my tone of voice was so plain I couldn't imagine myself acting this way all the time. Non speech in language is one of the most important things when you're trying to decide what kind of conversation it is because what if I was trying to be sarcastic and the other person wouldn't be able to tell because my tone of voice stayed the same and not once changed. Reading a persons body language is also a big part of it because you're able to figure out a lot by just watching the way they act. I am honestly one of those persons that doesn't do so well when it comes to reading someone else's body language. I feel like they can show one thing but really be feeling another so it isn't always accurate.

Piltdown Hoax

Unfortunately many were fooled for a little over 40 years.... The scientific community searched for a fossil or something to prove something that has had people wonder for many years, in the early twentieth century that they hoped to prove a relationship between the man and an ape, then one day in 1907 they found a jawbone that they thought was a fossil that represented both species. Of course, the researches wanted to find something that made them more sure about what they had found. Then on 1912 Dawson and Woodward found two skull parts and a jawbone. As they both examined the bones they assumed they belonged with each other. And because they assumed it was all from the same skull they got very happy because it displayed characteristics of a man and a ape. The jaw was like one that belonged to an ape and the skull fragments of a human. December 1912, Woodward argues that the skull he found was from a Piltdown Man who lived about half a million years ago.  Many people questioned the fact that there could be a relationship because the jawbone seemed to just belong to an ape but not a human and ape put together. For over 4o years the scientific believed Woodwards argument and then suddenly one day it was proven to be fake. As they found more and more skulls over the years of humans that lived long ago they realized that the skull that was argued over for so long was nothing like the ones that they had been finding. They found out it was fake because they used a fluorine-based test to see how old the skull was. They found out that the skull fragments were over 50,000 years old but the jawbone only appeared to be a few decades old. Some museum researches said that someone must have taken a jawbone from and ape and stained it in order to make it look ancient.... Crazy isn't it? Human Faults that have taken place in this is how people are very gullible, and will believe anything they are told without even going deep into the research and finding out themselves. It was a very good thing that they found out it was a fraud because, It can help us many ways. It stops this from happening any other time in the future and they now know that people will pull anything in order to get credit for a certain situation. The fact that they researched this very well and tested it for example like using the fluorine based test, is very good because we find out how long those bones have been around for. It is not possible to remove the human factor from science because who else would research things that we do not have answers to? it is very tough to even really be sure what to believe because although you can research for years and years I believe no one will ever really be sure of anything. A life lesson that this has taught me is that anyone can trick you into believing something that really isn't valid, it can start from science to anything personal. Don't ever be too gullible!!

Comparative Primate Blog Post

Lemurs:

Environment - Lemurs reside in Madagascar, an island South East of Africa and in the Comoro Islands. The climate in Madagascar is very tropical but at some times very dry. Madagascar consists of beaches, lagoons, mountains, rivers, grassland and even desert. The island use to be mostly forest but unfortunately most of that is gone. Most Lemurs live on trees and spend most of their time at the top of the rain forests.

Sociality and Mating Patterns - Lemurs are social primates and love to interact with others of their own kind. They usually live in groups of 25. It is said that lemurs who live in larger social groups are smarter and best at social cognition. A lemurs mating season is very short, about less than three weeks per year. The smaller the species the more that can be born at once. A bigger lemur species can only have about 1 or 2. Depending on the resources available to the lemurs (like food) would be if they reproduced or not. When they choose not to reproduce it is due to the fact that they cant provide and they also want to survive. The time of year that the lemurs mate can also be a big factor because that affects when their baby is born which could be during winter, spring or summer. I think this is a big factor of that the Lemur has to adapt to that relates to the trait because they have to be smart for example when there is no food supply the lemur adapts and doesn't mate because it does not want to reproduce.

Spider Monkey:

Environment - Spider Monkeys live in the tropical rain forests of central and south America and up as north to Mexico. They use their long arms to swing from tree to tree.

Sociality and Mating Patterns -Spider Monkeys live in groups of approximately 35 members, usually led by females and they are the ones who decide how large the group will be. If there is plenty of food to be found in their habitat then they won't mind if their group grows a little. When the group gets to large to even handle she breaks them up into small groups and each group goes their own way. They believe that they have a better chance of surviving that way instead of being in one large group. Spider Monkeys are very vocal and depend on it a lot to warn each other, to protect their young or even the environment. Spider Monkeys do not have a specific mating season. They will just let it happen whenever they want to, but they will only mate if and only if there is enough food in the environment. Female spider monkeys are very picky when it comes down to picking a mate.

I think spider monkeys have been influenced by the environment mostly when it comes down to mating, because they don't have specific times to do so but if they see that there is not enough resources then they choose not to reproduce and that is what to me seems like the spider monkey adapting.

Baboon: 

Environment - Baboons are found to live in Africa and Arabia. Baboons prefer to live in the Savanna and/or other semi-arid habitats, some do choose to live in rain forests.

Sociality and Mating Patterns - Baboons usually live in groups or so called "troops" consisting of 15-150 members. In the groups there are adult males and adult females and their offsprings. Females usually always remain in the same group for the rest of their lives. But Males tend to leave and go to other troops in order to mate. The baboons create relationships whiting the groups and usually their friendship consists o grooming each other, or if they like each other and choose each other to be each others mating partner. 

I think they use their trait and adapt because they live in large groups I believe they do so to protect each other from hard since they do live in a area where there are all kinds of animals.

Gibbon:

Environment - Gibbons live in the forests of southern Asia, and perfectly adapt to their life in the trees. They rarely ever come to the ground, they spend most of their time up in the trees.

Sociality and Mating - Gibbons live in small stable family groups, unlike the other primates they have a stable family that they stick to ( a ale and a female that mate for life and their offspring who is most likely younger than 7 years old). When they reproduce Gibbons are pregnant for 7 months, and have one baby at a time.

I think that their trait is influenced by the environment because they are stable and always up in trees they only stick to one mating partner for life.

Chimpanzee : 

Environment - Chimpanzees are found in Africa, they inhabit 22 African countries. They live in rain forests which use to be equatorial forest belt of Africa. Chimps are both terrestrial and arboreal.

Sociality and Mating - Like humans, Chimpanzees love social interactions with others. They live in social groups known as communities or unit groups that usually consist of 40 to 60 members. They split up into groups of 10 when they travel or go out to look for food. When it comes down to Mating a female chimpanzee who is known to be attractive may be accompanied my many of the males in her group or sometimes even all of them. Sometimes there is a dominant male in the group who possesses over her and shows violent actions that prevent other males from mating with her.

I think that their trait gets influenced by the environment because they split up into smaller groups to go look for food, I think that if the resources were available or if it was easy to travel in large groups then they would not bother to split up.

In conclusion, what I found to be the biggest influence by the environment was the resources found in the habitat. A lot of the primates would not reproduce if they did not have food around them that was available for when they have their baby. 

Homologous Traits

The species I selected for this assignment are the cat and the dolphin, it might seem a little weird because you're probably thinking to yourself how in the world are these to animals related? Well, they both carry the homologous trait which means similarities between organisms based on descent from a common ancestor. The paw of a cat and the flipper of a dolphin have very much in common. They have different functions but both include the humerus, ulna and radius. All of the bones listed show that they both have a common ancestor. A cat uses its paw to climb up trees and any high area but a dolphin uses its flipper for steering itself through water along with the tail. Cats and dolphins both use these parts of their bodies to "travel" from one place to another.  The front limbs on a dolphin are called flippers, the bones inside the flippers are similar to the bones in a humans arm and hand also inside the cats forearm and paw. Dolphins descendants 'Cetaceans' are from land mammals which can lead to why dolphins and cats have similar bone structures. Land mammals became adapted to aquatic life which could be why the dolphin lives in water and the cat lives on land.

Analogous Traits

The two species that I decided to compare for the analogous traits are a butterfly and an owl. As we all know both butterflies and owls have wings. Both species use their wings for survival and to fly from one place to another.  Both of these species adapted to the environment of living in air which is why they developed wings which are used for flying.They have more differences than similarities, An owl has one pair of wings but a butterfly has two. A butterfly does not have any bones in its wings and an owl does. An owls wings are covered in feathers but a butterflies wings are covered in scales.

Protein Synthesis

TACACCCTTTGGGTCTGAAAATCTACGACTGCAAGCCCCATC

Charles Darwin and Charles Lyell

Charles Darwin was known to many as the "Father of Evolution" but some do not know that many of his ideas came from other people as well. He was influenced by many others and the one I believe to be the most influential over him is Charles Lyell. He was mostly influenced by Lyells theory once he read his Principles of Geology when he was on the Beagle Voyage. While on the voyage Darwin experienced an earthquake that scared him very much which made him believe Lyells theory even more. The reason for Darwin being influenced while on the voyage was because Lyell believed that the geological events that happened at the beginning of time are the exact same ones that will happen again. A point that relates to Darwins and Lyells influence from "How does evolution work?" would be how as the environment changes species will change as well so they will be best suited for the environment. They believed that there must be changes in the earth in order to change the species because without any changes the species will remain the same and will not adapt to changes in the future. I do not believe that Charles Darwin could have constructed his theory without the influence of Lyell. They both contributed to their ideas because Charles Darwin in a way also influenced Lyell very much. One "Origin of Species" was published it opened many of those religious peoples eyes because it made them question life and its origins also everything they had believed previously.

Sources:
http://www.pbs.org/wgbh/evolution/library/02/4/l_024_01.html
http://evolution.about.com/od/Darwin/tp/People-Who-Influenced-Charles-Darwin.htm